1.
Main steps in the formation of Recombinant DNA are given below. Arrange these steps in a correct sequence. A. Insertion of recombinant DNA into the host cell. B. Cutting of DNA at specific location by restriction enzyme. C. Isolation of desired DNA fragment. D. Amplification of gene of interest using PCR. Choose the correct answer from the options given below:
2.
Which of the following is characteristic feature of cockroach regarding sexual dimorphism?
3.
Large, colourful, fragrant flowers with nectar are seen in:
4.
Given below are two statements:
| Statement 1: RNA mutates at a faster rate. |
| Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster. |
| In the light of the above statements, choose the correct answer from the options given below: |
5.
. Which hormone promotes internode/petiole elongation in deep water rice?
6.
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.
| Assertion A: Amniocentesis for sex determination is one of the strategies of Reproductive and Child Health Care Programme. |
| Reason R Ban on amniocentesis checks increasing menace of female foeticide. |
| In the light of the above statements, choose the correct answer from the options given below: |
7.
In angiosperm, the haploid, diploid and triploid structures of a fertilized embryo sac sequentially are:
8.
Which of the following functions is carried out by cytoskeleton in a cell?
9.
Which of the following statements are correct about Klinefelter's Syndrome?
| A. This disorder was first described by Langdon Down (1866). |
| B. Such an individual has overall masculine development. However, development is also expressed. the feminine |
| C. The affected individual is short statured. |
| D. Physical, psychomotor and mental development is retarded. |
| E. Such individuals are sterile. |
Choose the correct answer from the options given below:
10.
Identify the correct statements:
| |
| A. Detrivores perform fragmentation. |
| B. The humus is further degraded by some microbes during mineralization. |
| C. Water soluble inorganic nutrients go down into the soil and get precipitated by a process called leaching. |
| D. The detritus food chain begins with living organisms. |
| E. Earthworms break down detritus into smaller particles by a process called catabolism. |
| Choose the correct answer from the option given below: |
11.
Given below are two statements:
| Statement I: Vas deferens receives a duct from seminal vesicle and opens into urethra as the ejaculatory duct. |
| Statement II: The cavity of the cervix is called cervical canal which along with vagina forms birth canal. |
| In the light of the above statements, choose the correct answer from the options given below: |
12.
Match List I with List II
| List I | List II |
| (A) CCK | (I) Kidney |
| (B) GIP | (II) Heart |
| (C) ANF | (III) Gastric gland |
| (D) ADH | (IV) Pancreas |
Choose the correct answer from the options given below:
13.
Which one of the following techniques does not serve the purpose of early diagnosis of a disease for its early treatment?
14.
Given below are two statements:
| Statement I: During G, phase of cell cycle, the cell is metabolically inactive. |
| Statement II: The centrosome undergoes duplication during S phase of interphase. |
| |
| In the light of the above statements, choose the most appropriate answer from the options given below: |
15.
What is the role of RNA polymerase III in the process of transcription in Eukaryotes?
16.
Once the undigested and unabsorbed substances enter the caecum, their backflow is prevented by -
17.
What is the function of tassels in the con cob?
18.
Match List I with List II:
| List I | List II |
| A. M Phase | i.Protien are synthesized |
| B. G, Phase | II. Inactive phase |
| C. Quiescent stage | iii. Interval between mitosis and initiation of DNA replication |
| D. G. Phase | IV. Equational division |
Choose the correct answer from the options given below:
19.
Which one of the following common sexually transmitted diseases is completely curable when detected early and treated properly?
20.
Broad palm with single palm crease is visible in a person suffering from -
21.
. In tissue culture experiments, leaf mesophyll cells are put in a culture medium to form callus. This phenomenon may be called as:
22.
Match List I with List II:
| List 1 | List II |
| A. Iron | 1. Synthesis of auxin |
| B. Zinc | II. Component of nitrate reductase |
| C. Boron | III. Activator of catalase |
| D. Molybdenum | IV. Cell elongation and differentiation |
Choose the correct answer from the options given below:
23.
During the purification process for recombinant DNA technology, addition of chilled ethanol precipitates out
24.
The phenomenon of pleiotropism refers to
25.
Vital capacity of lung is
26.
. Spraying of which of the following phytohormone on juvenile conifers helps in hastening the maturity period, that leads to early seed production?
27.
Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R. Assertion A: In gymnosperms the pollen grains are released from the microsporangium and carried by air currents.
| Assertion A and other is labled as Reason R |
| Assertion A : In gymnosperms the pollen grains are released from the microsporangium and carried by air currents. |
| Reason R: Air currents carry the pollen grains to the mouth of the archegonia where the male gametes are discharged and pollen tube is not formed. |
| In the light of the above statements, choose the correct answer from the options given below: |
28.
Match List I with List II.
| List I | List II. |
| A. Mast cells | 1. Ciliated epithelium |
| B. Inner surface of bronchiole | II. Areolar connective tissue |
| C. Blood | III. Cuboidal epithelium |
| D. Tubular parts of nephron | IV. specialised connective tissue |
Choose the correct answer from the options give below:
29.
In cockroach, excretion is brought about by-
| A. Phallic gland |
| B. Urecose gland |
| C. Nephrocytes |
| D. Fat body |
| E. Collaterial glands |
Choose the correct answer from the options given below:
30.
In gene gun method used to introduce alien DNA metal are into host cells, microparticles of used.
31.
Movement and accumulation of ions across a membrane against their concentration gradient can be explained by
32.
Match List I with List II
| List I | List II |
| A. P-wave | i. Beginning of systole |
| B. Q-wave | II. Repolarisation of ventricles |
| C. QRS complex | III. Depolarisation of atria |
| D. T-wave | IV. Depolarisation of ventricles |
Choose the correct answer from the options given below:
33.
Given below are two statements:
| Statement I: Low temperature preserves the enzyme in a temporarily inactive state whereas high temperature destroys enzymatic activity because proteins are denatured by heat. |
| Statement II: When the inhibitor closely resembles the substrate in its molecular structure and inhibits the activity of the enzyme, it is known as competitive inhibitor. |
| In the light of the above statements, choose the correct answer from the options given below: |
34.
Which of the following combinations is required for chemiosmosis?
35.
Which one of the following statements is NOT correct?
36.
Match List I with List II.
| List 1 | List II |
| (Type of Joint) | (Found between) |
| A. Cartilaginous Joint | I. Between flat skull bones |
| B. Ball and Socket Joint | II. Between adjacent vertebrae in vertebral column |
| C. Fibrous Joint | III. Between carpal and metacarpal of thumb |
| D. Saddle Joint | IV. Between Humerus and Pectoral girdle |
Choose the correct answer from the options given below:
37.
The historic Convention on Biological Diversity, The Earth Summit' was held in Rio de Janeiro in the year:
38.
In which blood corpuscles, the HIV undergoes replication and produces progeny viruses?
39.
Select the correct statements.
| A. Tetrad formation is seen during Leptotene. |
| B. During Anaphase, the centromeres split and chromatids separate. |
| C. Terminalization takes place during Pachytene. |
| D. Nucleolus, Golgi complex and ER are reformed during Telophase. |
| E. Crossing over takes place between sister chromatids of homologous chromosome. |
| Choose the correct answer from the options given below: |
40.
Unequivocal proof that DNA is the genetic material. was first proposed by
41.
Cellulose does not form blue colour with lodine because
42.
Identify the correct statements:
| A. Lenticels are the lens-shaped openings permitting the exchange of gases. |
| B. Bark formed early in the season is called hard bark. |
| C. Bark is a technical term that refers to all tissues exterior to vascular cambium. |
| D. Bark refers to periderm and secondary phloem. |
| E. Phellogen is single-layered in thickness. |
| Choose the correct answer from the options given below |
43.
Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:
| Assertion A Late wood has fewer xylary elements with narrow vessels. |
| Reason R: Cambium is less active in winters. |
| In the light of the above statements, choose the correct answer from the options given below: |
44.
Which of the following are NOT considered as the part of endomembrane system?
| A. Mitochondria | |
| B. Endoplasmic Reticulum | |
| C. Chloroplasts | |
| D. Golgi complex | |
| E. Peroxisomes | |
Choose the most appropriate answer from the options given below:
45.
Given below are statements one is labelled as Assertion A and the other is labelled as Reason R.
| Assertion A: Nephrons are of two types: Cortical & Juxta medullary, based on their relative position in cortex and medulla. |
| Reason R: Juxta medullary nephrons have short loop of Henle whereas, cortical nephrons have longer loop of Henle. |
| In the light of the above statements, choose the correct answer from the options given below: |
46.
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows
5' AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3?
47.
Given below are two statements:
| Statement 1: Gause's 'Competitive Exclusion Principle states that two closely related species competing for the same resources cannot co-exist indefinitely and competitively inferior one will be eliminated eventually. |
| Statement II In general, carnivores are more adversely affected by competition than herbivores. |
| In the light of the above statements, choose the correct answer from the options given below: |
48.
Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R.
| Assertion A: A flower is defined as modified. shoot where in the shoot apical meristem changes to floral meristem. |
| Reason R: Internode of the shoot gets condensed to produce different floral appendages laterally at successive nodes instead of leaves. |
| In the light of the above statements, choose the correct answer from the options given below: |
49.
Match List I with List II.
| List I | List II |
| (Interacting species) | (Name of Interaction) |
| A. A Leopard and a Lion in a forest/grassland | I. Competition |
| B. A Cuckoo laying egg in a Crow's nest | II. Brood parasitism |
| C. Fungi and root of a higher plant in Mycorrtizae | III. Mutualism |
| D. A cattle egret and a Cattle in a field | IV. Commensalism |
Choose the correct answer from the options given below:
50.
Given below are two statements:
| Statement 1: Ligaments are dense irregular tissue |
| Statement II: Cartilage is dense regular tissue. |
| In the light of the above statements, choose the correct answer from the options given below: |
51.
How many different proteins does the ribosome consist of?
52.
Given below are two statements:
| One is labelled as Assertion A and the other is labelled as Reason R: |
| Assertion A ATP is used at two steps in glycolysis. |
| into glucose-6-phosphate and second ATP is used in conversion of fructose-6-phosphate into fructose-1-6-diphosphate. |
| In the light of the above statements, choose the correct answer from the options given below: |
53.
Family Fabaceae differs from Solanaceae and Liliaceae. With respect to the stamens, pick out the characteristics specific to family. Fabaceae but not found in Solanaceae or Liliaceae.
54.
Match List I with List II:
| List I | List II |
| (Interaction) | (Species A and B) |
| A. Mutualism | 1. +(A), O(B) |
| B. Commensalism | II. -(A), O(B) |
| C. Amensalism | III. +(A), (B) |
| D. Parasitism | IV. +(A), +(B) |
Choose the correct answer from the options given below:
55.
Match List I with List II.
| List I | List II |
| A. Ringworm | I. Haemophilus influenzae |
| B. Filariasis | II. Trichophyton |
| C. Malaria | III. Wuchereria bancrofti |
| D. Pneumonia | IV. Plasmodium vivax |
Choose the correct answer from the options given below:
56.
Given below are two statements:
| Statement 1: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. |
| Statement II In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome. |
| In the light of the above statements, choose the correct answer from the options given below: |
57.
The thickness of ozone in a column of air in the atmosphere is measured in terms of :
58.
Expressed Sequence Tags (ESTs) refers to
59.
Match List I with List II.
| List I | List II |
| A. Taenia | I. Nephridia |
| B. Paramoecium | II.Contractile vacuole |
| C. Periplaneta | III Flame cells |
| D. Pheretima | IV. Urecose gland |
Choose the correct answer from the options give below:
60.
Among eukaryotes, replication of DNA takes place in-
61.
Match List I with List II:
| List I | List II |
| A. Cohesion | I. More attraction in liquid phase |
| B. Adhesion | II. Mutual attraction among water molecules |
| C. Surface tension | III. Water loss in liquid phase |
| D. Guttation | IV. Attraction towards polar surfaces |
Choose the correct answer from the options given below:
62.
Given below are two statements:
| Statement 1 Electrostatic precipitator is most widely used in thermal power plant. |
| Statement II: Electrostatic precipitator in thermal power plant removes ionising radiations |
| In the light of the above statements, choose the most appropriate answer from the options given below: |
63.
In the equation
| GPP-R-NPP |
| GPP is Gross Primary Productivity |
| NPP is Net Primary Productivity |
| R here is |
64.
Given below are two statements:
| Statement I: Endarch and exarch are the terms often used for describing the position of secondary xylem in the plant body. |
| Statement II: Exarch condition is the most common feature of the root system. |
| In the light of the above statements, choose the correct answer from the options given below: |
65.
Which of the following statements are correct?
| A. An excessive loss of body fluid from the body switches off osmoreceptors. |
| B. ADH facilitates water reabsorption to prevent diuresis. |
| C. ANF causes vasodilation. |
| D. ADH causes increase in blood pressure. |
| E. ADH is responsible for decrease in GFR. |
Choose the correct answer from the options given below:
66.
Which of the following are NOT under the control of thyroid hormone?
| A. Maintenance of water and electrolyte balance |
| B. Regulation of basal metabolic rate |
| C. Normal rhythm of sleep-wake cycle |
| D. Development of immune system |
| E. Support the process of R.B.Cs formation |
Choose the correct answer from the options given below:
67.
Match List I with List II.
| List 1 | List II |
| A. Vasectomy | I. Oral method |
| B. Coitus interruptus. | II. Barrier method |
| C. Cervical caps | III. Surgical method |
| D. Saheli | IV. Natural method |
Choose the correct answer from the options given below:
68.
Upon exposure to UV radiation, DNA stained with ethidium bromide will show
69.
Which of the following stages of meiosis involves division of centromere?
70.
Which of the following statements is correct?
71.
Given below are two statements:
| One is labelled as Assertion A and the other is labelled as Reason R: |
| Assertion A: The first stage of gametophyte in the life cycle of moss is protonema stage. |
| Reason R Protonema develops directly from spores produced in capsule. |
| In the light of the above statements, choose the most appropriate answer from the options given below: |
72.
Which of the following statements are correct regarding skeletal muscle?
| A. Muscle bundles are held together by collagenous connective tissue layer called fascicle. |
| B. Sarcoplasmic reticulum of muscle fibre is a store house of calcium ions. |
| C. Striated appearance of skeletal muscle fibre is due to distribution pattern of actin and myosin proteins. |
| D. M line is considered as functional unit of contraction called sarcomere. |
Choose the most appropriate answer from the options given below:
73.
Match List I with List II.
| List I | |
| (Cells) | (Secretion) |
| A. Peptic cells | I Mucus |
| B. Goblet cells | II. Bile juice |
| C. Oxyntic cells | III. Proenzyme pepsinogen |
| D. Hepatic cells | IV. HCl and intrinsic factor for absorption of vitamin |
| | B₁₂ |
Choose the correct answer from the options given below:
74.
Which of the following statements are correct regarding female reproductive cycle?
| A. In non-primate mammals cyclical changes during reproduction are called oestrus cycle. |
| B. First menstrual cycle begins at puberty and is called menopause. |
| C. Lack of menstruation may be indicative of pregnancy. |
| D. Cyclic menstruation extends between menarche and menopause. |
Choose the most appropriate answer from the options given below:
75.
. Identify the pair of heterosporous pteridophytes among the following:
76.
Select the correct statements with reference to chordates.
| A. Presence of mid-dorsal, solid and double nerve cord. |
| B. Presence of closed circulatory system |
| C. Presence of paired pharyngeal gillslits. |
| D. Presence of dorsal heart |
| E. Triploblastic pseudocoelomate animals |
Choose the correct answer from the options given below:
77.
Match List I with List II.
| List I | List II |
| A. Heroin | 1. Effect on cardiovascular system |
| B. Marijuana | II. Slow down body function |
| C. Cocaine | III.Painkiller |
| D. Morphine | IV. Interfere with transport of dopamine |
Choose the correct answer from the options given below:
78.
Given below are two statements:
| Statement 1: The forces generated by transpiration can lift a xylem-sized column of water over 130 meters height. |
| Statement II: Transpiration cools leaf surfaces sometimes 10 to 15 degrees, by evaporative cooling. |
| In the light of the above statements, choose the most appropriate answer from the options given below: |
80.
Which of the following is not a cloning vector?
81.
The parts of human brain that helps in regulation of sexual behaviour, expression of excitement, pleasure, rage, fear etc. are:
82.
Select the correct group/set of Australian Marsupials exhibiting adaptive radiation.
83.
How many ATP and NADPH, are required for the synthesis of one molecule of Glucose during Calvin cycle?
84.
The reaction centre in PS II has an absorption maxima at
85.
The unique mammalian characteristics are:
86.
Frequency of recombination between gene pairs on same chromosome as a measure of the distance between genes to map their position on chromosome, was used for the first time by
87.
Match List I with List II.
| List 1 | List II |
| A. Logistic growth | 1. Unlimited resource availability condition |
| B. Exponential growth | II. Limited resource availability condition |
| C. Expanding age pyramid | III. The percent individuals of pre-reproductive age is largest followed by reproductive and post reproductive age groups |
| D. Stable age pyramid | IV. The percent individuals of pre-reproductives and reproductive age group are same |
Choose the correct answer from the options given below:
88.
Which one of the following symbols represents mating between relatives in human pedigree analysis?
89.
Melonate inhibits the growth of pathogenic bacteria by inhibiting the activity of
90.
Match List I with List II with respect to human eye.
| List I | List II |
| A. Fovea | i. Visible coloured portion of eye that regulates diameter of pupil. |
| B. Iris | II. External layer of eye formed of dense connective tissue. |
| C. Blind spot | III. Point of greatest visual acuity or resolution. |
| D. Sclera | IV. Point where optic nerve leaves the eyeball and photoreceptor cells are absent. |
Choose the correct answer from the options given below:
91.
The process of appearance of recombination nodules occurs at which sub stage of prophase I in meiosis?
92.
Which of the following statements are correct?
| A. Basophils are most abundant cells of the total WBCS |
| B. Basophils secrete histamine, serotonin and heparin |
| C. Basophils are involved in inflammatory response |
| D. Basophils have kidney shaped nucleus |
| E. Basophils are agranulocytes |
Choose the correct answer from the options given below:
93.
Match List I with List II.
| List 1 | List II |
| A. Gene a | 1. B-galactosidase. |
| B. Gene 'y | II. Transacetylase |
| C. Gene | III. Permease |
| D. Gene 'z | IV. Repressor protein |
Choose the correct answer from the options given below:
94.
Given below are two statements:
| Statement I: A protein is imagined as a line, the left end represented by first amino acid (C-terminal) and the right end represented by last amino acid (N-terminal). |
| Statement II: Adult human haemoglobin, consists of 4 subunits (two subunits of a type and two subunits ẞ type.) |
| In the light of the above statements, choose the correct answer from the options given below: |
95.
Among The Evil Quartet', which one is considered the most important cause driving extinction of species?
96.
Match List I with List II:
| List 1 | List II |
| A. Oxidative decarboxylation | i. Citrate synthase |
| B. Glycolysis | II. Pyruvate dehydrogenase |
| C. Oxidative phosphorylation | III. Electron transport sytem |
| D. Tricarboxylic acid cycle | IV. EMP pathway |
Choose the correct answer from the options given below:
97.
Which micronutrient is required for splitting of water molecule during photosynthesis?
98.
Radial symmetry is NOT found in adults of phylum
99.
Which one of the following is NOT an advantage of inbreeding?
100.
Axile placentation is observed in